Transcript: Mouse NM_172517.2

Mus musculus retinoblastoma binding protein 5, histone lysine methyltransferase complex subunit (Rbbp5), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rbbp5 (213464)
Length:
3632
CDS:
143..1759

Additional Resources:

NCBI RefSeq record:
NM_172517.2
NBCI Gene record:
Rbbp5 (213464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034411 CCGGATTGTTATTTGGGATTT pLKO.1 280 CDS 100% 10.800 15.120 N Rbbp5 n/a
2 TRCN0000034412 CCGACCCATCATAGCTTCTAT pLKO.1 1060 CDS 100% 5.625 7.875 N Rbbp5 n/a
3 TRCN0000034409 CGTTTGAATAATCATGGCTTT pLKO.1 2429 3UTR 100% 4.050 5.670 N Rbbp5 n/a
4 TRCN0000431475 AGAGAAAGATTCTCCATTTAA pLKO_005 1621 CDS 100% 15.000 10.500 N Rbbp5 n/a
5 TRCN0000422035 GAGAATCAGAATTTGATATTG pLKO_005 1185 CDS 100% 13.200 9.240 N Rbbp5 n/a
6 TRCN0000034413 GCCTTCTGTAGCAGTGATGAA pLKO.1 1295 CDS 100% 4.950 3.465 N Rbbp5 n/a
7 TRCN0000034410 GCTCTATTGTATTTACCCATT pLKO.1 1334 CDS 100% 4.050 2.835 N Rbbp5 n/a
8 TRCN0000159776 GTAAAGAGAAAGATTCTCCAT pLKO.1 1617 CDS 100% 2.640 1.848 N RBBP5 n/a
9 TRCN0000418649 GTCACAGTGGGATGTTCTTTC pLKO_005 412 CDS 100% 10.800 6.480 N Rbbp5 n/a
10 TRCN0000353567 TGGAGCCGAGATGGTCATAAA pLKO_005 362 CDS 100% 13.200 9.240 N RBBP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06848 pDONR223 100% 92.5% 99% None (many diffs) n/a
2 TRCN0000475189 CATTTCTGTCCGGTTCTTCAGACT pLX_317 21.1% 92.5% 99% V5 (many diffs) n/a
Download CSV