Transcript: Mouse NM_172566.4

Mus musculus RUN domain containing 1 (Rundc1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rundc1 (217201)
Length:
3230
CDS:
20..1867

Additional Resources:

NCBI RefSeq record:
NM_172566.4
NBCI Gene record:
Rundc1 (217201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172566.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247723 GCCTATCAGGAGGGTAGTTAT pLKO_005 626 CDS 100% 13.200 18.480 N Rundc1 n/a
2 TRCN0000247727 GCCAAGAATGGCCGTGCATAT pLKO_005 1469 CDS 100% 10.800 15.120 N Rundc1 n/a
3 TRCN0000247725 CAGCACTCCTCTGGTTATAAA pLKO_005 2687 3UTR 100% 15.000 12.000 N Rundc1 n/a
4 TRCN0000215640 GTGATCATCGATGAGTTAATA pLKO.1 686 CDS 100% 15.000 12.000 N Rundc1 n/a
5 TRCN0000247726 GTGATCATCGATGAGTTAATA pLKO_005 686 CDS 100% 15.000 12.000 N Rundc1 n/a
6 TRCN0000247724 GTCCTTTGCTCTGCCTATAAT pLKO_005 1519 CDS 100% 15.000 10.500 N Rundc1 n/a
7 TRCN0000190151 GTTCAGCCTTCCTGTAGACTT pLKO.1 1807 CDS 100% 4.950 3.465 N Rundc1 n/a
8 TRCN0000135320 CATGAATCTGAATGAGGACAT pLKO.1 718 CDS 100% 4.050 2.835 N RUNDC1 n/a
9 TRCN0000201846 GCAGAAAGAACTGATTCTGCA pLKO.1 571 CDS 100% 0.264 0.185 N Rundc1 n/a
10 TRCN0000136209 GAGAAGCAGAAAGAACTGATA pLKO.1 566 CDS 100% 4.950 3.465 N RUNDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172566.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09639 pDONR223 100% 86.5% 88.7% None (many diffs) n/a
2 ccsbBroad304_09639 pLX_304 0% 86.5% 88.7% V5 (many diffs) n/a
3 TRCN0000479390 CGTGATCTTCTTTGACCATACCTA pLX_317 15.6% 86.5% 88.7% V5 (many diffs) n/a
Download CSV