Transcript: Mouse NM_172586.4

Mus musculus zinc finger protein 322A (Zfp322a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Zfp322a (218100)
Length:
4844
CDS:
377..1609

Additional Resources:

NCBI RefSeq record:
NM_172586.4
NBCI Gene record:
Zfp322a (218100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172586.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085526 GTCGAAGTACAAATCTCATAA pLKO.1 900 CDS 100% 13.200 18.480 N Zfp322a n/a
2 TRCN0000301668 GTCGAAGTACAAATCTCATAA pLKO_005 900 CDS 100% 13.200 18.480 N Zfp322a n/a
3 TRCN0000304348 GTGAAAGACTCCTAGGTAAAT pLKO_005 1660 3UTR 100% 13.200 18.480 N Zfp322a n/a
4 TRCN0000085527 CAGTCGAAGTACAAATCTCAT pLKO.1 898 CDS 100% 4.950 6.930 N Zfp322a n/a
5 TRCN0000085525 CATACCATGTATGCCCTCAAA pLKO.1 458 CDS 100% 4.950 3.960 N Zfp322a n/a
6 TRCN0000418005 AGTGGGAAATCAGATCTTATT pLKO_005 983 CDS 100% 13.200 9.240 N ZNF322P1 n/a
7 TRCN0000085523 CCAGAGAACAACCATGTAAAT pLKO.1 1931 3UTR 100% 13.200 9.240 N Zfp322a n/a
8 TRCN0000304393 TGTACATGAGATTACTCAAAT pLKO_005 502 CDS 100% 13.200 9.240 N Zfp322a n/a
9 TRCN0000304395 TACTCGAAGTGCCAACCTAAT pLKO_005 1234 CDS 100% 10.800 7.560 N Zfp322a n/a
10 TRCN0000085524 GCTTGGAGTGTATGAGAAGTT pLKO.1 1212 CDS 100% 4.950 3.465 N Zfp322a n/a
11 TRCN0000301669 GCTTGGAGTGTATGAGAAGTT pLKO_005 1212 CDS 100% 4.950 3.465 N Zfp322a n/a
12 TRCN0000017205 CTTCTTCAACATCAGACAGTA pLKO.1 1502 CDS 100% 4.950 3.465 N ZNF322 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172586.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04109 pDONR223 100% 86.1% 83.1% None (many diffs) n/a
2 ccsbBroad304_04109 pLX_304 0% 86.1% 83.1% V5 (many diffs) n/a
3 TRCN0000467632 TCACAACTCAACTTATGCCCTGGT pLX_317 33.3% 86.1% 83.1% V5 (many diffs) n/a
Download CSV