Transcript: Mouse NM_172594.2

Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 29 (Dhx29), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Dhx29 (218629)
Length:
4098
CDS:
1..4098

Additional Resources:

NCBI RefSeq record:
NM_172594.2
NBCI Gene record:
Dhx29 (218629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172594.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113068 CGATGTAAGGAACTTTGACTA pLKO.1 1080 CDS 100% 4.950 6.930 N Dhx29 n/a
2 TRCN0000113067 CCTCACGATCTACAATGCTTA pLKO.1 3402 CDS 100% 4.950 3.960 N Dhx29 n/a
3 TRCN0000113069 CCTCACGATGTAAGGAACTTT pLKO.1 1075 CDS 100% 5.625 3.938 N Dhx29 n/a
4 TRCN0000113065 GCTCACATTCAACAGTTGTAT pLKO.1 2629 CDS 100% 5.625 3.938 N Dhx29 n/a
5 TRCN0000113066 CCAGCCATAAAGATTTCACAT pLKO.1 937 CDS 100% 4.950 2.970 N Dhx29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172594.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08389 pDONR223 100% 84.7% 90.7% None (many diffs) n/a
2 ccsbBroad304_08389 pLX_304 0% 84.7% 90.7% V5 (many diffs) n/a
3 TRCN0000466283 ATCAGTCGGTATACTGACAGGAAT pLX_317 8.9% 84.7% 90.7% V5 (many diffs) n/a
Download CSV