Transcript: Mouse NM_172612.3

Mus musculus Rho family GTPase 1 (Rnd1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rnd1 (223881)
Length:
2203
CDS:
113..811

Additional Resources:

NCBI RefSeq record:
NM_172612.3
NBCI Gene record:
Rnd1 (223881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089695 ACTCATCTCAACTACATTCAA pLKO.1 757 CDS 100% 5.625 7.875 N Rnd1 n/a
2 TRCN0000089697 CAACTACATTCAAGAAGGAAA pLKO.1 765 CDS 100% 4.950 3.465 N Rnd1 n/a
3 TRCN0000089696 GCTGCAAGACAGATCTTCGAA pLKO.1 483 CDS 100% 3.000 2.100 N Rnd1 n/a
4 TRCN0000089694 GAGACAAGCATCCACAGCATT pLKO.1 629 CDS 100% 4.950 2.970 N Rnd1 n/a
5 TRCN0000089693 GCTTCCTAAGTGCTGGGATTA pLKO.1 1836 3UTR 100% 10.800 5.400 Y Rnd1 n/a
6 TRCN0000047433 TGGAGCTTAGTCTCTGGGATA pLKO.1 294 CDS 100% 4.050 2.835 N RND1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172612.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03017 pDONR223 100% 89.5% 96.5% None (many diffs) n/a
2 ccsbBroad304_03017 pLX_304 0% 89.5% 96.5% V5 (many diffs) n/a
3 TRCN0000465571 TGTAGCCATAGAGGTGAGCAAAGG pLX_317 36.7% 89.5% 96.5% V5 (many diffs) n/a
Download CSV