Transcript: Mouse NM_172637.3

Mus musculus HECT domain E3 ubiquitin protein ligase 2 (Hectd2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-17
Taxon:
Mus musculus (mouse)
Gene:
Hectd2 (226098)
Length:
4771
CDS:
146..2470

Additional Resources:

NCBI RefSeq record:
NM_172637.3
NBCI Gene record:
Hectd2 (226098)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412949 GTCAGTACCCATTCGTTATTT pLKO_005 1245 CDS 100% 15.000 21.000 N Hectd2 n/a
2 TRCN0000413785 CAGTATTGAAGGGAATCATTA pLKO_005 759 CDS 100% 13.200 18.480 N Hectd2 n/a
3 TRCN0000092109 GCGACTCACTTGATGAGTTAA pLKO.1 1422 CDS 100% 1.320 1.848 N Hectd2 n/a
4 TRCN0000428292 GGAGTAATTAAATCCTATAAC pLKO_005 1913 CDS 100% 13.200 10.560 N Hectd2 n/a
5 TRCN0000092112 AGCTTGTTACAAGAATGGAAA pLKO.1 782 CDS 100% 4.950 3.465 N Hectd2 n/a
6 TRCN0000092108 CCAGCATTTAGTACCAGCTTA pLKO.1 3783 3UTR 100% 4.950 3.465 N Hectd2 n/a
7 TRCN0000092110 CCCTCGTTCCTTACACTGATT pLKO.1 1137 CDS 100% 4.950 3.465 N Hectd2 n/a
8 TRCN0000092111 GCTGACCATCACTTCCTAGTT pLKO.1 926 CDS 100% 4.950 3.465 N Hectd2 n/a
9 TRCN0000429680 TATAGTGAAGGCATGATTTAA pLKO_005 2627 3UTR 100% 15.000 9.000 N Hectd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491311 AGACCCACCAAAACAATGAAACTA pLX_317 9.4% 88.9% 89.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488652 GGGGAAACATCGGCAACATGCCAC pLX_317 14.4% 88.9% 89.3% V5 (many diffs) n/a
Download CSV