Transcript: Mouse NM_172663.4

Mus musculus enhancer of polycomb homolog 2 (Drosophila) (Epc2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Epc2 (227867)
Length:
4358
CDS:
321..2747

Additional Resources:

NCBI RefSeq record:
NM_172663.4
NBCI Gene record:
Epc2 (227867)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172663.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359790 GGTCATAATGGACCGAATATC pLKO_005 1700 CDS 100% 13.200 18.480 N EPC2 n/a
2 TRCN0000417478 GGTCATAATGGACCGAATATC pLKO_005 1700 CDS 100% 13.200 18.480 N Epc2 n/a
3 TRCN0000108984 GCAACCCTTCATAATGGAAAT pLKO.1 1218 CDS 100% 10.800 15.120 N Epc2 n/a
4 TRCN0000108983 CCTGTCAATGTGCATATCAAT pLKO.1 2544 CDS 100% 5.625 4.500 N Epc2 n/a
5 TRCN0000359722 ACAACGAGCAACCAGATTATG pLKO_005 646 CDS 100% 13.200 9.240 N EPC2 n/a
6 TRCN0000108981 CCCAAGCAGTTCATTCATATT pLKO.1 609 CDS 100% 13.200 9.240 N Epc2 n/a
7 TRCN0000363358 GACATTGCCTGTGATCAATAA pLKO_005 1385 CDS 100% 13.200 9.240 N EPC2 n/a
8 TRCN0000420706 GACATTGCCTGTGATCAATAA pLKO_005 1385 CDS 100% 13.200 9.240 N Epc2 n/a
9 TRCN0000108980 CCAGGTATGTATTGCATCATA pLKO.1 3590 3UTR 100% 5.625 3.938 N Epc2 n/a
10 TRCN0000062736 GCAGAGAGCAACGTCAACTAT pLKO.1 555 CDS 100% 5.625 3.938 N EPC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172663.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11813 pDONR223 100% 91.4% 93.9% None (many diffs) n/a
Download CSV