Transcript: Mouse NM_172693.3

Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (Galnt12), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Galnt12 (230145)
Length:
2216
CDS:
21..1751

Additional Resources:

NCBI RefSeq record:
NM_172693.3
NBCI Gene record:
Galnt12 (230145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422463 CAGCGTACACGGTTGTCATTC pLKO_005 1814 3UTR 100% 10.800 15.120 N Galnt12 n/a
2 TRCN0000110283 GAACTCTACTACCACCGCAAT pLKO.1 1182 CDS 100% 4.050 5.670 N Galnt12 n/a
3 TRCN0000110282 CGATTATGATAACCTGCCCAA pLKO.1 395 CDS 100% 2.160 1.728 N Galnt12 n/a
4 TRCN0000421976 TGCTGTGAGTAAGAGATATTT pLKO_005 950 CDS 100% 15.000 10.500 N Galnt12 n/a
5 TRCN0000423607 CAGCGACAGAGAGCACCTAAA pLKO_005 536 CDS 100% 10.800 7.560 N Galnt12 n/a
6 TRCN0000110281 CCCGGAAAGAAATACGCTATA pLKO.1 1480 CDS 100% 10.800 7.560 N Galnt12 n/a
7 TRCN0000439871 GGTACTGCCTTGACTACAATC pLKO_005 1372 CDS 100% 10.800 7.560 N Galnt12 n/a
8 TRCN0000110284 GCACCAGATCAACATCTATCT pLKO.1 305 CDS 100% 4.950 3.465 N Galnt12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172693.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.