Transcript: Mouse NM_172716.4

Mus musculus polycomb group ring finger 3 (Pcgf3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pcgf3 (69587)
Length:
3731
CDS:
311..1036

Additional Resources:

NCBI RefSeq record:
NM_172716.4
NBCI Gene record:
Pcgf3 (69587)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172716.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095496 CCATTACAGTATATCGGTCAT pLKO.1 500 CDS 100% 4.050 5.670 N Pcgf3 n/a
2 TRCN0000095498 GACTGAGTGTTTGCACACATT pLKO.1 400 CDS 100% 4.950 3.465 N Pcgf3 n/a
3 TRCN0000095495 GCTACACTACAGACCCAAGAT pLKO.1 1003 CDS 100% 4.950 3.465 N Pcgf3 n/a
4 TRCN0000095494 CCAGCTTTATTTACAGGCATA pLKO.1 3527 3UTR 100% 4.050 2.835 N Pcgf3 n/a
5 TRCN0000095497 CCTCCTTTAATGAGCTGGACA pLKO.1 894 CDS 100% 2.640 1.848 N Pcgf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172716.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14044 pDONR223 100% 88% 75.7% None (many diffs) n/a
2 ccsbBroad304_14044 pLX_304 0% 88% 75.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000470031 TCACGCTCTAAATTTCTGACACAG pLX_317 58.5% 88% 75.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV