Transcript: Mouse NM_172723.4

Mus musculus ArfGAP with dual PH domains 1 (Adap1), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Adap1 (231821)
Length:
2418
CDS:
103..1227

Additional Resources:

NCBI RefSeq record:
NM_172723.4
NBCI Gene record:
Adap1 (231821)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172723.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106150 CCACCTCAACAAGTATTTATT pLKO.1 1700 3UTR 100% 15.000 21.000 N Adap1 n/a
2 TRCN0000106151 GCCCTGAAATACTTCAACAAA pLKO.1 577 CDS 100% 5.625 3.938 N Adap1 n/a
3 TRCN0000106154 AGAGCCACATTTGAGTCCAAA pLKO.1 346 CDS 100% 4.950 3.465 N Adap1 n/a
4 TRCN0000106152 CCGAAGGCTCATGTACTTCAA pLKO.1 939 CDS 100% 4.950 3.465 N Adap1 n/a
5 TRCN0000106153 CGGAAGTTTGTGCTGACAGAA pLKO.1 547 CDS 100% 4.950 3.465 N Adap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172723.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07731 pDONR223 100% 88.3% 93.8% None (many diffs) n/a
2 ccsbBroad304_07731 pLX_304 0% 88.3% 93.8% V5 (many diffs) n/a
3 TRCN0000480735 GGCTAGCTGGATTGCCGGCAGTAA pLX_317 40.2% 88.3% 93.8% V5 (many diffs) n/a
Download CSV