Transcript: Mouse NM_172739.4

Mus musculus Rho GTPase activating protein 35 (Arhgap35), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Arhgap35 (232906)
Length:
8393
CDS:
714..5213

Additional Resources:

NCBI RefSeq record:
NM_172739.4
NBCI Gene record:
Arhgap35 (232906)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172739.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243512 AGGGCGTTGAGCGGTACATTA pLKO_005 1324 CDS 100% 13.200 18.480 N Arhgap35 n/a
2 TRCN0000216769 GAATATCCTTCGAAGTCTAAG pLKO.1 4361 CDS 100% 10.800 15.120 N Arhgap35 n/a
3 TRCN0000022187 CGGTACATTAGAGATGCACAT pLKO.1 1335 CDS 100% 4.050 5.670 N ARHGAP35 n/a
4 TRCN0000276086 CGGTACATTAGAGATGCACAT pLKO_005 1335 CDS 100% 4.050 5.670 N ARHGAP35 n/a
5 TRCN0000243511 TTTCGGGAAGATGCGACATTG pLKO_005 3702 CDS 100% 10.800 8.640 N Arhgap35 n/a
6 TRCN0000243513 CTAAGGCTAGAGGCACTATTA pLKO_005 7668 3UTR 100% 13.200 9.240 N Arhgap35 n/a
7 TRCN0000216719 CTTGATCAGTTCTCGCTTTAT pLKO.1 2429 CDS 100% 13.200 9.240 N Arhgap35 n/a
8 TRCN0000243514 CTTGATCAGTTCTCGCTTTAT pLKO_005 2429 CDS 100% 13.200 9.240 N Arhgap35 n/a
9 TRCN0000243515 TGGACTCCAAGCGCAACTTAA pLKO_005 2989 CDS 100% 13.200 9.240 N Arhgap35 n/a
10 TRCN0000022188 CGGTTGGTTCATGGGTACATT pLKO.1 3261 CDS 100% 5.625 3.938 N ARHGAP35 n/a
11 TRCN0000276090 CGGTTGGTTCATGGGTACATT pLKO_005 3261 CDS 100% 5.625 3.938 N ARHGAP35 n/a
12 TRCN0000174015 CCACTGGGTAAACAAGTCCTT pLKO.1 5921 3UTR 100% 2.640 1.848 N Arhgap35 n/a
13 TRCN0000174933 GAAAGAAACCACAGCAAGAAA pLKO.1 5864 3UTR 100% 5.625 3.375 N Arhgap35 n/a
14 TRCN0000022186 CGGGATAATCATTTAGTCCAT pLKO.1 2778 CDS 100% 2.640 3.696 N ARHGAP35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172739.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.