Transcript: Mouse NM_172742.2

Mus musculus myotubularin related protein 10 (Mtmr10), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mtmr10 (233315)
Length:
5205
CDS:
113..2428

Additional Resources:

NCBI RefSeq record:
NM_172742.2
NBCI Gene record:
Mtmr10 (233315)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172742.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081023 GCTCTTGTCTACTTATACAAA pLKO.1 3885 3UTR 100% 5.625 7.875 N Mtmr10 n/a
2 TRCN0000287854 GCTCTTGTCTACTTATACAAA pLKO_005 3885 3UTR 100% 5.625 7.875 N Mtmr10 n/a
3 TRCN0000295292 CTAGCAAATGAAGACTAAATT pLKO_005 2411 CDS 100% 15.000 10.500 N Mtmr10 n/a
4 TRCN0000081024 TCAGAGAAAGAGTCTCCTTTA pLKO.1 1466 CDS 100% 10.800 7.560 N Mtmr10 n/a
5 TRCN0000287853 TCAGAGAAAGAGTCTCCTTTA pLKO_005 1466 CDS 100% 10.800 7.560 N Mtmr10 n/a
6 TRCN0000082697 GCATTTGAATATGTTGGGAAA pLKO.1 641 CDS 100% 4.050 2.835 N MTMR10 n/a
7 TRCN0000081026 CTCATGCTTGAAGAATGGGAT pLKO.1 1864 CDS 100% 2.640 1.848 N Mtmr10 n/a
8 TRCN0000081027 GTAGGAAATCTGTGTAGACGA pLKO.1 2324 CDS 100% 2.640 1.848 N Mtmr10 n/a
9 TRCN0000298390 GTAGGAAATCTGTGTAGACGA pLKO_005 2324 CDS 100% 2.640 1.848 N Mtmr10 n/a
10 TRCN0000081025 CCAGCCAACCTACACGGCATT pLKO.1 2012 CDS 100% 1.350 0.945 N Mtmr10 n/a
11 TRCN0000287784 CCAGCCAACCTACACGGCATT pLKO_005 2012 CDS 100% 1.350 0.945 N Mtmr10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172742.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12105 pDONR223 100% 15.1% 11% None (many diffs) n/a
2 ccsbBroad304_12105 pLX_304 0% 15.1% 11% V5 (many diffs) n/a
3 TRCN0000470417 TGATTTTGGGTGATACGGCTTCTA pLX_317 71% 15.1% 11% V5 (many diffs) n/a
Download CSV