Transcript: Mouse NM_172780.4

Mus musculus solute carrier family 9 (sodium/hydrogen exchanger), member 6 (Slc9a6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-03-04
Taxon:
Mus musculus (mouse)
Gene:
Slc9a6 (236794)
Length:
4916
CDS:
26..2134

Additional Resources:

NCBI RefSeq record:
NM_172780.4
NBCI Gene record:
Slc9a6 (236794)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172780.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068828 GCCGTTTATATGGCATAGGAA pLKO.1 2246 3UTR 100% 3.000 4.200 N Slc9a6 n/a
2 TRCN0000068831 CCCAAGGAGATTTATGGGCAA pLKO.1 1972 CDS 100% 2.160 3.024 N Slc9a6 n/a
3 TRCN0000068832 CCTTGGGTCTATCTTAGCATA pLKO.1 649 CDS 100% 4.950 3.960 N Slc9a6 n/a
4 TRCN0000304189 CTGAATGTGTAAGCTATATAA pLKO_005 2223 3UTR 100% 15.000 10.500 N SLC9A6 n/a
5 TRCN0000068830 CCCTTGTCTCTCTTACTTAAT pLKO.1 1415 CDS 100% 13.200 9.240 N Slc9a6 n/a
6 TRCN0000068829 CCATCATGTATGGCTGTGTAA pLKO.1 711 CDS 100% 4.950 3.465 N Slc9a6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172780.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07618 pDONR223 100% 90.5% 96% None (many diffs) n/a
2 ccsbBroad304_07618 pLX_304 0% 90.5% 96% V5 (many diffs) n/a
3 TRCN0000478526 AAGAGACCTCTCTCATGGTACATT pLX_317 15.4% 90.5% 96% V5 (many diffs) n/a
Download CSV