Transcript: Mouse NM_172781.2

Mus musculus kelch-like 4 (Klhl4), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-05-26
Taxon:
Mus musculus (mouse)
Gene:
Klhl4 (237010)
Length:
3884
CDS:
92..2245

Additional Resources:

NCBI RefSeq record:
NM_172781.2
NBCI Gene record:
Klhl4 (237010)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090609 CCCTCGTACAAAGCCTAGAAA pLKO.1 1342 CDS 100% 5.625 7.875 N Klhl4 n/a
2 TRCN0000090611 CGGATATGATGGTCATACTTA pLKO.1 2116 CDS 100% 5.625 7.875 N Klhl4 n/a
3 TRCN0000090610 GCGGATATGATGGTCATACTT pLKO.1 2115 CDS 100% 5.625 7.875 N Klhl4 n/a
4 TRCN0000090612 GCATTAAACAATAGGCTGTAT pLKO.1 1787 CDS 100% 4.950 3.960 N Klhl4 n/a
5 TRCN0000090608 CCATGTAAACACCTTCCATTA pLKO.1 3027 3UTR 100% 10.800 7.560 N Klhl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14215 pDONR223 100% 86.1% 87.4% None (many diffs) n/a
2 ccsbBroad304_14215 pLX_304 0% 86.1% 87.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000478041 CATTATCGTAACAATCCTTGAAGT pLX_317 20.7% 86.1% 87.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV