Transcript: Mouse NM_172798.1

Mus musculus T-box 4 (Tbx4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tbx4 (21387)
Length:
2961
CDS:
251..1609

Additional Resources:

NCBI RefSeq record:
NM_172798.1
NBCI Gene record:
Tbx4 (21387)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433070 GATGACGAGACTACCTGTATC pLKO_005 1605 CDS 100% 10.800 15.120 N Tbx4 n/a
2 TRCN0000421031 GTCTTCTGACATGCAACTAAG pLKO_005 1791 3UTR 100% 10.800 15.120 N Tbx4 n/a
3 TRCN0000084570 GCCCACTTTAGTGTGTACAAT pLKO.1 1376 CDS 100% 5.625 4.500 N Tbx4 n/a
4 TRCN0000084569 GACCAAGTACATACTTCTCAT pLKO.1 295 CDS 100% 4.950 3.960 N Tbx4 n/a
5 TRCN0000425968 GTCATCCTTACAGTATCATTC pLKO_005 1552 CDS 100% 10.800 7.560 N Tbx4 n/a
6 TRCN0000084571 CAGCACTACCAGTATGAGAAT pLKO.1 866 CDS 100% 4.950 3.465 N Tbx4 n/a
7 TRCN0000084572 TCGCTACAAGTTCTGTGACAA pLKO.1 340 CDS 100% 4.950 3.465 N Tbx4 n/a
8 TRCN0000415111 GCCATGCCAGGAAGACTTTAT pLKO_005 392 CDS 100% 13.200 7.920 N Tbx4 n/a
9 TRCN0000084568 CCCTTCTTATTGCAGTGAGGT pLKO.1 1108 CDS 100% 2.640 1.584 N Tbx4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07430 pDONR223 100% 72.8% 77.1% None (many diffs) n/a
2 ccsbBroad304_07430 pLX_304 0% 72.8% 77.1% V5 (many diffs) n/a
Download CSV