Transcript: Mouse NM_172827.3

Mus musculus leucyl/cystinyl aminopeptidase (Lnpep), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Lnpep (240028)
Length:
5181
CDS:
78..3155

Additional Resources:

NCBI RefSeq record:
NM_172827.3
NBCI Gene record:
Lnpep (240028)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172827.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031109 CCTGCTTTAATCCTAGAGTTT pLKO.1 4726 3UTR 100% 4.950 6.930 N Lnpep n/a
2 TRCN0000296802 TTCTTAGATGCTCGATTTAAA pLKO_005 1608 CDS 100% 15.000 12.000 N LNPEP n/a
3 TRCN0000031110 CCCACTTAAGAAATTGGATTT pLKO.1 1313 CDS 100% 10.800 7.560 N Lnpep n/a
4 TRCN0000031111 CCTTATGTTCTGAGTGACAAA pLKO.1 2235 CDS 100% 4.950 3.465 N Lnpep n/a
5 TRCN0000031113 GCAGCTATCCAAAGTGATGAT pLKO.1 1821 CDS 100% 4.950 3.465 N Lnpep n/a
6 TRCN0000031112 GCCATTATTCCTCTATGCTAT pLKO.1 588 CDS 100% 4.950 3.465 N Lnpep n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172827.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06534 pDONR223 100% 85.9% 73.8% None (many diffs) n/a
2 ccsbBroad304_06534 pLX_304 0% 85.9% 73.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468534 TTACGATGGTTATGACATTATATG pLX_317 7.5% 85.9% 73.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV