Transcript: Mouse NM_172843.4

Mus musculus torsin A interacting protein 2 (Tor1aip2), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tor1aip2 (240832)
Length:
5857
CDS:
946..2454

Additional Resources:

NCBI RefSeq record:
NM_172843.4
NBCI Gene record:
Tor1aip2 (240832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172843.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277441 GGACCTATGGTTCCGTGTTTC pLKO_005 1688 CDS 100% 10.800 15.120 N Tor1aip2 n/a
2 TRCN0000196207 GCTTAGCGATGGGTTTGAGAA pLKO.1 2091 CDS 100% 4.950 6.930 N Tor1aip2 n/a
3 TRCN0000277369 GCTTAGCGATGGGTTTGAGAA pLKO_005 2091 CDS 100% 4.950 6.930 N Tor1aip2 n/a
4 TRCN0000277371 CACCAGAGTCACACCGAATAA pLKO_005 1065 CDS 100% 13.200 9.240 N Tor1aip2 n/a
5 TRCN0000196099 GCTCCGTCAACAGCTACTATT pLKO.1 1739 CDS 100% 13.200 9.240 N Tor1aip2 n/a
6 TRCN0000180743 GCTGAGTTTCACAGAGAAGTT pLKO.1 3391 3UTR 100% 4.950 3.465 N Tor1aip2 n/a
7 TRCN0000277370 GCTGAGTTTCACAGAGAAGTT pLKO_005 3391 3UTR 100% 4.950 3.465 N Tor1aip2 n/a
8 TRCN0000179322 GCTGACTTTGAACTTAGAGTA pLKO.1 4360 3UTR 100% 4.950 2.970 N Tor1aip2 n/a
9 TRCN0000285958 GCTGACTTTGAACTTAGAGTA pLKO_005 4360 3UTR 100% 4.950 2.970 N Tor1aip2 n/a
10 TRCN0000148760 CCACATGGACTCAGACAAATT pLKO.1 2349 CDS 100% 13.200 9.240 N TOR1AIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172843.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.