Transcript: Mouse NM_172844.2

Mus musculus flavin containing monooxygenase 9 (Fmo9), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Fmo9 (240894)
Length:
3065
CDS:
213..1832

Additional Resources:

NCBI RefSeq record:
NM_172844.2
NBCI Gene record:
Fmo9 (240894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099253 TCTGGATTACATCCGATTTAA pLKO.1 515 CDS 100% 15.000 21.000 N Fmo9 n/a
2 TRCN0000099250 GCAAGTTATTTGCCGAGAAAT pLKO.1 2762 3UTR 100% 13.200 18.480 N Fmo9 n/a
3 TRCN0000099254 GACCCGAATTACAAGTGAGAA pLKO.1 1712 CDS 100% 4.950 6.930 N Fmo9 n/a
4 TRCN0000099252 CCATCAGTGATGACCTTCCAA pLKO.1 1063 CDS 100% 3.000 2.100 N Fmo9 n/a
5 TRCN0000099251 GCAGACATGGACCAAAGGAAA pLKO.1 1431 CDS 100% 4.950 2.970 N Fmo9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10538 pDONR223 100% 24.6% 25.6% None (many diffs) n/a
2 ccsbBroad304_10538 pLX_304 0% 24.6% 25.6% V5 (many diffs) n/a
3 TRCN0000469621 CTCTTTTGCTCGAACTACCCCATT pLX_317 68.6% 24.6% 25.6% V5 (many diffs) n/a
Download CSV