Transcript: Mouse NM_172863.4

Mus musculus zinc finger protein 697 (Zfp697), mRNA.

Source:
NCBI, updated 2019-01-21
Taxon:
Mus musculus (mouse)
Gene:
Zfp697 (242109)
Length:
5170
CDS:
136..1845

Additional Resources:

NCBI RefSeq record:
NM_172863.4
NBCI Gene record:
Zfp697 (242109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172863.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086401 CCGGCAACAAGCCTCACAAAT pLKO.1 1754 CDS 100% 13.200 9.240 N Zfp697 n/a
2 TRCN0000419414 GAAAGAGGAATGGGCTCTAAT pLKO_005 241 CDS 100% 13.200 9.240 N Zfp697 n/a
3 TRCN0000424319 TTGCCCTAACACCTCACTTAT pLKO_005 2261 3UTR 100% 13.200 9.240 N Zfp697 n/a
4 TRCN0000086400 ACCCACAGGATGATGATCTAA pLKO.1 311 CDS 100% 5.625 3.938 N Zfp697 n/a
5 TRCN0000086398 CGCTTGATAGAGGAGGAAGAT pLKO.1 556 CDS 100% 4.950 3.465 N Zfp697 n/a
6 TRCN0000423577 TGGATTCTGACTTGGAGAACT pLKO_005 194 CDS 100% 4.950 3.465 N Zfp697 n/a
7 TRCN0000431062 CATTGCCTACTCCCGTGCTTC pLKO_005 578 CDS 100% 1.350 0.945 N Zfp697 n/a
8 TRCN0000422075 GAAGCGCTTCAGCGACTTCTC pLKO_005 1620 CDS 100% 1.350 0.945 N Zfp697 n/a
9 TRCN0000086402 TGTCAGAATCTGACAGCATAT pLKO.1 467 CDS 100% 1.080 0.756 N Zfp697 n/a
10 TRCN0000427758 GAGAACTGAGATAGGTGATTT pLKO_005 2163 3UTR 100% 13.200 7.920 N Zfp697 n/a
11 TRCN0000430679 CAGAAGTTGCACTTGTGTTAG pLKO_005 1825 CDS 100% 10.800 6.480 N Zfp697 n/a
12 TRCN0000092881 GAGGAAGATGAAGAGGAGGAA pLKO.1 505 CDS 100% 2.640 1.320 Y Gm4169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172863.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.