Transcript: Mouse NM_172866.3

Mus musculus RAB6A GEF compex partner 1 (Rgp1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rgp1 (242406)
Length:
5868
CDS:
289..1464

Additional Resources:

NCBI RefSeq record:
NM_172866.3
NBCI Gene record:
Rgp1 (242406)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184260 GCAGCCTCCATCTGTACAATA pLKO.1 914 CDS 100% 13.200 9.240 N Rgp1 n/a
2 TRCN0000183708 GTCAGTCAAATATGTCTACAA pLKO.1 678 CDS 100% 4.950 3.465 N Rgp1 n/a
3 TRCN0000183609 GAATTTGTAACATCCCGAGAA pLKO.1 1267 CDS 100% 4.050 2.835 N Rgp1 n/a
4 TRCN0000182979 CAAATCATATTCCTACAGTGA pLKO.1 618 CDS 100% 2.640 1.848 N Rgp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172866.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02254 pDONR223 100% 88.8% 96.9% None (many diffs) n/a
2 ccsbBroad304_02254 pLX_304 0% 88.8% 96.9% V5 (many diffs) n/a
3 TRCN0000468636 ACACCGCTACCATTGGGTAACTCC pLX_317 37.3% 88.8% 96.9% V5 (many diffs) n/a
Download CSV