Transcript: Mouse NM_172891.2

Mus musculus serine/threonine/tyrosine kinase 1 (Styk1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Styk1 (243659)
Length:
3378
CDS:
846..2135

Additional Resources:

NCBI RefSeq record:
NM_172891.2
NBCI Gene record:
Styk1 (243659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172891.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362260 AGGTGTTAAGGTGAGTCAATA pLKO_005 2634 3UTR 100% 13.200 18.480 N Styk1 n/a
2 TRCN0000362253 TCCTAGACAAATGACTATATA pLKO_005 2142 3UTR 100% 15.000 10.500 N Styk1 n/a
3 TRCN0000362254 AGCAGTATGAAGTAATCATTG pLKO_005 922 CDS 100% 10.800 7.560 N Styk1 n/a
4 TRCN0000023730 CCAGGAACATCCTGATCCAAA pLKO.1 1621 CDS 100% 4.950 3.465 N Styk1 n/a
5 TRCN0000023729 CGAGAGAAGCAGTATGAAGTA pLKO.1 915 CDS 100% 4.950 3.465 N Styk1 n/a
6 TRCN0000023732 TGCTCTATGATCTCACAGAAA pLKO.1 1516 CDS 100% 4.950 3.465 N Styk1 n/a
7 TRCN0000023731 GCCTAGAAGCTGCTTCTAGAT pLKO.1 2002 CDS 100% 0.495 0.347 N Styk1 n/a
8 TRCN0000362330 TCCCACCAGCATCCTACAATA pLKO_005 1859 CDS 100% 13.200 7.920 N Styk1 n/a
9 TRCN0000023733 GTGCCTGAACTGTATGCAGAT pLKO.1 2064 CDS 100% 4.050 2.430 N Styk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172891.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.