Transcript: Mouse NM_172958.3

Mus musculus myotubularin related protein 12 (Mtmr12), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mtmr12 (268783)
Length:
4518
CDS:
106..2349

Additional Resources:

NCBI RefSeq record:
NM_172958.3
NBCI Gene record:
Mtmr12 (268783)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172958.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238190 AGGATCGTCAGTGGCATAATC pLKO_005 595 CDS 100% 13.200 18.480 N Mtmr12 n/a
2 TRCN0000238192 ATAGATAACAGTTCGGAATTT pLKO_005 1123 CDS 100% 13.200 18.480 N Mtmr12 n/a
3 TRCN0000238194 CTAGGCAAGAGAATTAGTAAA pLKO_005 1876 CDS 100% 13.200 18.480 N Mtmr12 n/a
4 TRCN0000081169 CGTTTCAAACATCAACGACAA pLKO.1 1771 CDS 100% 4.050 5.670 N Mtmr12 n/a
5 TRCN0000081170 CCACCCTACGAGATGGTTAAA pLKO.1 1024 CDS 100% 13.200 10.560 N Mtmr12 n/a
6 TRCN0000238191 GACTTAAACCATAGCATATTC pLKO_005 2726 3UTR 100% 13.200 10.560 N Mtmr12 n/a
7 TRCN0000081171 CCAGAGTGCATACTGTAAATT pLKO.1 1086 CDS 100% 15.000 10.500 N Mtmr12 n/a
8 TRCN0000238193 GAATAAGATCATAGGAGTAAA pLKO_005 408 CDS 100% 13.200 9.240 N Mtmr12 n/a
9 TRCN0000081172 CCAAAGCACAGACGTTACTTA pLKO.1 1694 CDS 100% 5.625 3.938 N Mtmr12 n/a
10 TRCN0000081168 CCCTCCATAATAATGCACAAT pLKO.1 3609 3UTR 100% 4.950 3.465 N Mtmr12 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2762 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172958.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12057 pDONR223 99.7% 80.8% 83.2% None (many diffs) n/a
2 ccsbBroad304_12057 pLX_304 0% 80.8% 83.2% V5 (many diffs) n/a
3 TRCN0000466159 CAACCTATACCTGGAGATCATGTT pLX_317 20.8% 80.8% 83.2% V5 (many diffs) n/a
Download CSV