Transcript: Human NM_173077.3

Homo sapiens carboxypeptidase O (CPO), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CPO (130749)
Length:
1245
CDS:
83..1207

Additional Resources:

NCBI RefSeq record:
NM_173077.3
NBCI Gene record:
CPO (130749)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173077.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423965 CTTAACATAGATGGTTATATC pLKO_005 530 CDS 100% 13.200 18.480 N CPO n/a
2 TRCN0000047080 GCAAAGTATGGAACCAATTAT pLKO.1 896 CDS 100% 15.000 12.000 N CPO n/a
3 TRCN0000047078 GCACTCTTATGGGCAGTTAAT pLKO.1 787 CDS 100% 13.200 9.240 N CPO n/a
4 TRCN0000430050 TGGAGGGCTGGGATATGATAG pLKO_005 130 CDS 100% 10.800 7.560 N CPO n/a
5 TRCN0000047079 CCATCTGGTAATCCCAAGAAA pLKO.1 359 CDS 100% 5.625 3.938 N CPO n/a
6 TRCN0000047082 GAGACGTATTCCTATAACATA pLKO.1 209 CDS 100% 5.625 3.938 N CPO n/a
7 TRCN0000047081 GCCAATGGTTCGTCAAAGAAA pLKO.1 435 CDS 100% 5.625 3.938 N CPO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173077.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09528 pDONR223 100% 99.6% 99.1% None (many diffs) n/a
2 ccsbBroad304_09528 pLX_304 0% 99.6% 99.1% V5 (many diffs) n/a
3 TRCN0000475888 CTCTAAATGACAAGACCAGCTCTG pLX_317 30.3% 99.6% 99.1% V5 (many diffs) n/a
Download CSV