Transcript: Mouse NM_173384.2

Mus musculus SRY (sex determining region Y)-box 30 (Sox30), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Sox30 (214105)
Length:
2995
CDS:
11..2359

Additional Resources:

NCBI RefSeq record:
NM_173384.2
NBCI Gene record:
Sox30 (214105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081918 CCGTTCATGTCTTCCCAAGTT pLKO.1 2485 3UTR 100% 4.950 6.930 N Sox30 n/a
2 TRCN0000081919 GCAAGACCTAAGGTTCCCTTT pLKO.1 862 CDS 100% 4.050 5.670 N Sox30 n/a
3 TRCN0000017423 CCCTTCAGTAAGGACAGAAAT pLKO.1 1079 CDS 100% 13.200 9.240 N SOX30 n/a
4 TRCN0000017425 CCTCTAAGTGTTTCCAATGTA pLKO.1 1346 CDS 100% 5.625 3.938 N SOX30 n/a
5 TRCN0000081922 GCCTCCCTTTGGCTATGGAAA pLKO.1 1996 CDS 100% 4.950 3.465 N Sox30 n/a
6 TRCN0000081920 CCTTTCAGAGACTATCCAGAT pLKO.1 2108 CDS 100% 4.050 2.835 N Sox30 n/a
7 TRCN0000081921 GCCTTCTGAGTTGATACGGTT pLKO.1 934 CDS 100% 2.640 1.848 N Sox30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.