Transcript: Mouse NM_173413.3

Mus musculus RAB8B, member RAS oncogene family (Rab8b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rab8b (235442)
Length:
4751
CDS:
73..696

Additional Resources:

NCBI RefSeq record:
NM_173413.3
NBCI Gene record:
Rab8b (235442)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295363 AGTGCAAAGTCGAGTACAAAT pLKO_005 523 CDS 100% 13.200 18.480 N Rab8b n/a
2 TRCN0000381585 ACGATAGAACTCGACGGAAAG pLKO_005 217 CDS 100% 6.000 8.400 N Rab8b n/a
3 TRCN0000100536 CCGAACAATTACGACAGCATA pLKO.1 282 CDS 100% 4.950 6.930 N Rab8b n/a
4 TRCN0000100539 CAAATGTGATATGAACGACAA pLKO.1 435 CDS 100% 4.050 5.670 N Rab8b n/a
5 TRCN0000287931 CAAATGTGATATGAACGACAA pLKO_005 435 CDS 100% 4.050 5.670 N Rab8b n/a
6 TRCN0000295424 TTTACACTTGCACGGGATATA pLKO_005 559 CDS 100% 13.200 10.560 N Rab8b n/a
7 TRCN0000100537 CCGGTCTAAGAAGACCAGTTT pLKO.1 654 CDS 100% 0.495 0.396 N Rab8b n/a
8 TRCN0000047879 CCTGGGTAACAAATGTGATAT pLKO.1 426 CDS 100% 13.200 9.240 N RAB8B n/a
9 TRCN0000382238 GAATGATCCTGGGTAACAAAT pLKO_005 419 CDS 100% 13.200 9.240 N RAB8B n/a
10 TRCN0000295425 AGAAGTTAGCAATTGACTATG pLKO_005 482 CDS 100% 10.800 7.560 N Rab8b n/a
11 TRCN0000380343 ATAACAGAGAGCCGGTCTAAG pLKO_005 643 CDS 100% 10.800 7.560 N Rab8b n/a
12 TRCN0000100538 CAGGAAAGATTCCGAACAATT pLKO.1 271 CDS 100% 13.200 7.920 N Rab8b n/a
13 TRCN0000100535 GCCAAGAACTAACAGAACTTT pLKO.1 4325 3UTR 100% 5.625 3.375 N Rab8b n/a
14 TRCN0000287930 GCCAAGAACTAACAGAACTTT pLKO_005 4325 3UTR 100% 5.625 3.375 N Rab8b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03380 pDONR223 100% 92.5% 98.5% None (many diffs) n/a
2 ccsbBroad304_03380 pLX_304 0% 92.5% 98.5% V5 (many diffs) n/a
3 TRCN0000478806 GCCCACGTACTTGGGCGTTCCTCG pLX_317 56.6% 92.5% 98.5% V5 (many diffs) n/a
Download CSV