Transcript: Human NM_173473.4

Homo sapiens anaphase promoting complex subunit 16 (ANAPC16), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ANAPC16 (119504)
Length:
3231
CDS:
155..487

Additional Resources:

NCBI RefSeq record:
NM_173473.4
NBCI Gene record:
ANAPC16 (119504)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172494 CAAGTGGCATCCACGCTTAAA pLKO.1 338 CDS 100% 13.200 10.560 N ANAPC16 n/a
2 TRCN0000250524 CAAGTGGCATCCACGCTTAAA pLKO_005 338 CDS 100% 13.200 10.560 N Anapc16 n/a
3 TRCN0000172921 GATCTGGTTTCAGTGTCTCAG pLKO.1 213 CDS 100% 4.050 2.835 N ANAPC16 n/a
4 TRCN0000168244 CAGGTGAAACATGATCAGCAA pLKO.1 359 CDS 100% 2.640 1.848 N ANAPC16 n/a
5 TRCN0000168433 GCTGGAGAGATGTTAGAAGAT pLKO.1 278 CDS 100% 4.950 2.970 N ANAPC16 n/a
6 TRCN0000172674 GTTCTGTCACTGGATCTGGTT pLKO.1 201 CDS 100% 2.640 1.584 N ANAPC16 n/a
7 TRCN0000040213 CCTCCCAAATTGCTGGGATTA pLKO.1 1633 3UTR 100% 1.080 0.540 Y IGF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04737 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04737 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478532 AGCCAATTATCCTGTTGTGTCCCG pLX_317 90.5% 100% 100% V5 n/a
Download CSV