Transcript: Human NM_173475.4

Homo sapiens defective in cullin neddylation 1 domain containing 3 (DCUN1D3), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
DCUN1D3 (123879)
Length:
6136
CDS:
261..1175

Additional Resources:

NCBI RefSeq record:
NM_173475.4
NBCI Gene record:
DCUN1D3 (123879)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173475.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243521 TTACTGAAGATCCGGATATTT pLKO_005 1253 3UTR 100% 15.000 21.000 N Dcun1d3 n/a
2 TRCN0000158068 CCAGAACAATCCTCCGGTATT pLKO.1 902 CDS 100% 10.800 15.120 N DCUN1D3 n/a
3 TRCN0000243525 TCAAGGATCTCTACCGGTTTA pLKO_005 796 CDS 100% 10.800 15.120 N Dcun1d3 n/a
4 TRCN0000454786 TGCATCGGGAAATAGCCATTG pLKO_005 859 CDS 100% 6.000 8.400 N DCUN1D3 n/a
5 TRCN0000440384 CAGATCTCAGTTTCGCATATT pLKO_005 1596 3UTR 100% 13.200 9.240 N DCUN1D3 n/a
6 TRCN0000151803 CACTTGGAACATGTTCCTTAA pLKO.1 983 CDS 100% 10.800 7.560 N DCUN1D3 n/a
7 TRCN0000151793 CTCTTAACAGAAGCCAAACAA pLKO.1 765 CDS 100% 5.625 3.938 N DCUN1D3 n/a
8 TRCN0000151045 GCAAAGATTGGAAGAACTGTT pLKO.1 524 CDS 100% 4.950 3.465 N DCUN1D3 n/a
9 TRCN0000154015 CCTTAACTTCACTCAGGTGAT pLKO.1 998 CDS 100% 4.050 2.835 N DCUN1D3 n/a
10 TRCN0000156341 CGGTATTGGACCAATGGCTAA pLKO.1 916 CDS 100% 4.050 2.835 N DCUN1D3 n/a
11 TRCN0000153732 CCAAGTCTCTTTGACACCTTT pLKO.1 1059 CDS 100% 4.950 2.970 N DCUN1D3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173475.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.