Transcript: Human NM_173481.4

Homo sapiens mitotic spindle positioning (MISP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MISP (126353)
Length:
2885
CDS:
118..2157

Additional Resources:

NCBI RefSeq record:
NM_173481.4
NBCI Gene record:
MISP (126353)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173481.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116531 GCGCTGGGAATCCCGCATCTA pLKO.1 2115 CDS 100% 0.000 0.000 N MISP n/a
2 TRCN0000433261 CCCATCCACCTACACTCAAAC pLKO_005 1942 CDS 100% 10.800 7.560 N MISP n/a
3 TRCN0000416174 GATGAGGGTTGGCAGGTTTAC pLKO_005 382 CDS 100% 10.800 7.560 N MISP n/a
4 TRCN0000422523 TTCCGTTTCTATCTTCCTTTA pLKO_005 2330 3UTR 100% 10.800 7.560 N MISP n/a
5 TRCN0000116527 GCTGATTCTTTCTGCTTCTAA pLKO.1 2404 3UTR 100% 5.625 3.938 N MISP n/a
6 TRCN0000422253 TACGTGCAGCGGGACATAGTA pLKO_005 1165 CDS 100% 5.625 3.938 N MISP n/a
7 TRCN0000116530 CAGTCATCTGATCTGCTGGAA pLKO.1 1741 CDS 100% 2.640 1.848 N MISP n/a
8 TRCN0000116529 GACACCAGCTACACATACCAT pLKO.1 193 CDS 100% 3.000 1.800 N MISP n/a
9 TRCN0000116528 CCAGCTAGAATTCTCAGCCTT pLKO.1 1419 CDS 100% 0.000 0.000 N MISP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173481.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04814 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04814 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479312 CTTACCCAAAAACGGGGCAACCCC pLX_317 16.5% 100% 100% V5 n/a
Download CSV