Transcript: Human NM_173512.2

Homo sapiens solute carrier family 38 member 11 (SLC38A11), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
SLC38A11 (151258)
Length:
1724
CDS:
332..1486

Additional Resources:

NCBI RefSeq record:
NM_173512.2
NBCI Gene record:
SLC38A11 (151258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423738 GGACACACTCCGATAAGATTA pLKO_005 1266 CDS 100% 13.200 18.480 N SLC38A11 n/a
2 TRCN0000435120 AGCTAAGTGGTCCCGCCTTAT pLKO_005 844 CDS 100% 10.800 15.120 N SLC38A11 n/a
3 TRCN0000154594 GAACAGATACCTACCAGTCTT pLKO.1 435 CDS 100% 4.950 3.960 N SLC38A11 n/a
4 TRCN0000154757 GTGGGAATCTTTCATCGGTTT pLKO.1 1083 CDS 100% 4.050 3.240 N SLC38A11 n/a
5 TRCN0000157432 GCAAAGCCCAATGCCATTCAA pLKO.1 743 CDS 100% 5.625 3.938 N SLC38A11 n/a
6 TRCN0000152058 CAGGAAATGTTCTACTGCTTT pLKO.1 1376 CDS 100% 4.950 3.465 N SLC38A11 n/a
7 TRCN0000155078 GCAGAAATGATGACCTGGTAA pLKO.1 969 CDS 100% 4.950 3.465 N SLC38A11 n/a
8 TRCN0000157303 CTGATTGATTGCCTCGGGATA pLKO.1 1157 CDS 100% 4.050 2.835 N SLC38A11 n/a
9 TRCN0000155796 CAGTTACCTTTACTCTGCCTT pLKO.1 579 CDS 100% 2.640 1.848 N SLC38A11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05047 pDONR223 100% 94.5% 94.5% None 194_195ins66 n/a
2 ccsbBroad304_05047 pLX_304 0% 94.5% 94.5% V5 194_195ins66 n/a
3 TRCN0000473927 AGATGATTGTCTCCCCACTGTCCT pLX_317 37.7% 94.5% 94.5% V5 194_195ins66 n/a
Download CSV