Transcript: Human NM_173538.3

Homo sapiens cyclic nucleotide binding domain containing 1 (CNBD1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CNBD1 (168975)
Length:
1624
CDS:
82..1392

Additional Resources:

NCBI RefSeq record:
NM_173538.3
NBCI Gene record:
CNBD1 (168975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422951 TTGTGAAACTACGATCAAATA pLKO_005 1208 CDS 100% 13.200 18.480 N CNBD1 n/a
2 TRCN0000016173 CCGGAGTATGAGCAATATCTT pLKO.1 240 CDS 100% 5.625 7.875 N CNBD1 n/a
3 TRCN0000016177 GCTTAGCAAATGGAGTACCTT pLKO.1 852 CDS 100% 3.000 4.200 N CNBD1 n/a
4 TRCN0000016176 GCACATTAATTATGGCCAGTT pLKO.1 186 CDS 100% 4.050 3.240 N CNBD1 n/a
5 TRCN0000016174 CCTCAAACAAACGTGTATAAA pLKO.1 706 CDS 100% 15.000 10.500 N CNBD1 n/a
6 TRCN0000420412 GTCTCACATGACAGCTATTAA pLKO_005 114 CDS 100% 15.000 10.500 N CNBD1 n/a
7 TRCN0000016175 GCGTCCTTCTTCAAGTTCCTT pLKO.1 1298 CDS 100% 3.000 2.100 N CNBD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05147 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05147 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468954 AACCGTGGCGAAGCCTACCCTAAC pLX_317 29.6% 100% 100% V5 n/a
Download CSV