Transcript: Human NM_173623.3

Homo sapiens tubulin tyrosine ligase like 6 (TTLL6), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
TTLL6 (284076)
Length:
2542
CDS:
45..1799

Additional Resources:

NCBI RefSeq record:
NM_173623.3
NBCI Gene record:
TTLL6 (284076)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173623.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128712 CAAACAGTACATCCAGCCATT pLKO.1 878 CDS 100% 4.050 3.240 N TTLL6 n/a
2 TRCN0000434273 GTGGAGGGTTCCGACTGATTT pLKO_005 592 CDS 100% 13.200 9.240 N TTLL6 n/a
3 TRCN0000434328 CGGACAGGGTGGTATCCTTTA pLKO_005 1276 CDS 100% 10.800 7.560 N TTLL6 n/a
4 TRCN0000127680 CAACCTGGAAAGCTGTGACAA pLKO.1 434 CDS 100% 4.950 3.465 N TTLL6 n/a
5 TRCN0000128251 GTCTTCCATTAGTTCCTAGTA pLKO.1 1930 3UTR 100% 4.950 3.465 N TTLL6 n/a
6 TRCN0000127969 GCTGCAACTTCACAAGGTCAA pLKO.1 2298 3UTR 100% 4.050 2.835 N TTLL6 n/a
7 TRCN0000130066 GCCATTGACATTAGTATCCTA pLKO.1 893 CDS 100% 3.000 2.100 N TTLL6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173623.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13516 pDONR223 100% 97.3% 97.2% None 1_45del;71A>T n/a
2 ccsbBroad304_13516 pLX_304 0% 97.3% 97.2% V5 1_45del;71A>T n/a
3 TRCN0000480069 GACCGGGGGAAGAGGGCGTTAACA pLX_317 18.7% 97.3% 97.2% V5 1_45del;71A>T n/a
Download CSV