Transcript: Mouse NM_173751.4

Mus musculus ilvB (bacterial acetolactate synthase)-like (Ilvbl), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ilvbl (216136)
Length:
2348
CDS:
177..2075

Additional Resources:

NCBI RefSeq record:
NM_173751.4
NBCI Gene record:
Ilvbl (216136)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173751.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075982 GTGGTCAAGGTACTTCGTGAA pLKO.1 1965 CDS 100% 4.050 3.240 N Ilvbl n/a
2 TRCN0000222689 CGTGTGGTTGTCTGGTATTTA pLKO.1 879 CDS 100% 15.000 10.500 N Ilvbl n/a
3 TRCN0000075980 GCTGCCTCTTGATGTACTATA pLKO.1 797 CDS 100% 13.200 9.240 N Ilvbl n/a
4 TRCN0000075979 GCCTGTATTACAGCACCTGAA pLKO.1 1493 CDS 100% 4.050 2.835 N Ilvbl n/a
5 TRCN0000075978 GACTTTGTCTACCTGGAGTTT pLKO.1 2115 3UTR 100% 4.950 2.970 N Ilvbl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173751.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07720 pDONR223 100% 84.4% 86.3% None (many diffs) n/a
2 ccsbBroad304_07720 pLX_304 0% 84.4% 86.3% V5 (many diffs) n/a
3 TRCN0000478634 ATATACCACATAAATGTAGTGGCG pLX_317 16.9% 84.4% 86.3% V5 (many diffs) n/a
4 ccsbBroadEn_07721 pDONR223 100% 84.3% 86.2% None (many diffs) n/a
5 ccsbBroad304_07721 pLX_304 0% 84.3% 86.2% V5 (many diffs) n/a
6 TRCN0000470732 ACCGCTTGCATTTGGGATTTCTGC pLX_317 22.7% 84.3% 86.2% V5 (many diffs) n/a
Download CSV