Transcript: Mouse NM_173752.4

Mus musculus lectin, galactoside binding-like (Lgalsl), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Lgalsl (216551)
Length:
3635
CDS:
100..618

Additional Resources:

NCBI RefSeq record:
NM_173752.4
NBCI Gene record:
Lgalsl (216551)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173752.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111119 CAGTCGGCAATCCCTTACTTT pLKO.1 427 CDS 100% 5.625 3.938 N Lgalsl n/a
2 TRCN0000354081 CAGTCGGCAATCCCTTACTTT pLKO_005 427 CDS 100% 5.625 3.938 N Lgalsl n/a
3 TRCN0000111116 GCCGTGGTGAAACTTGATGAT pLKO.1 127 CDS 100% 4.950 3.465 N Lgalsl n/a
4 TRCN0000325991 GCCGTGGTGAAACTTGATGAT pLKO_005 127 CDS 100% 4.950 3.465 N Lgalsl n/a
5 TRCN0000111115 CCTGTGAATTAGCACAGTATT pLKO.1 1435 3UTR 100% 1.320 0.924 N Lgalsl n/a
6 TRCN0000326067 CCTGTGAATTAGCACAGTATT pLKO_005 1435 3UTR 100% 1.320 0.924 N Lgalsl n/a
7 TRCN0000281549 ATCTGCAATTGACACCATAAA pLKO_005 561 CDS 100% 13.200 7.920 N LGALSL n/a
8 TRCN0000111118 CCACGACTGATAGTTCCATTT pLKO.1 199 CDS 100% 10.800 6.480 N Lgalsl n/a
9 TRCN0000325994 CCACGACTGATAGTTCCATTT pLKO_005 199 CDS 100% 10.800 6.480 N Lgalsl n/a
10 TRCN0000282362 TGTACTTCCCACGACTGATAG pLKO_005 191 CDS 100% 10.800 6.480 N LGALSL n/a
11 TRCN0000111117 GCTGCTCAGAAACTCTTGTAT pLKO.1 384 CDS 100% 5.625 3.375 N Lgalsl n/a
12 TRCN0000326066 GCTGCTCAGAAACTCTTGTAT pLKO_005 384 CDS 100% 5.625 3.375 N Lgalsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173752.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03077 pDONR223 100% 91.6% 99.4% None (many diffs) n/a
2 ccsbBroad304_03077 pLX_304 0% 91.6% 99.4% V5 (many diffs) n/a
3 TRCN0000472163 TAATTCTATATAGTGAACGACCCC pLX_317 97.2% 91.6% 99.4% V5 (many diffs) n/a
Download CSV