Transcript: Mouse NM_173774.3

Mus musculus solute carrier family 45, member 1 (Slc45a1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Slc45a1 (242773)
Length:
2573
CDS:
173..2428

Additional Resources:

NCBI RefSeq record:
NM_173774.3
NBCI Gene record:
Slc45a1 (242773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416444 GCCAACAGGTCGCAAACATTC pLKO_005 1617 CDS 100% 10.800 15.120 N Slc45a1 n/a
2 TRCN0000437122 TGCGCAATCTCTGTGTCAATC pLKO_005 1749 CDS 100% 10.800 15.120 N Slc45a1 n/a
3 TRCN0000437832 CACGTCGGAAGCATATCAGAA pLKO_005 1864 CDS 100% 4.950 6.930 N Slc45a1 n/a
4 TRCN0000110837 GCATCAATGAGTTCGCATCAT pLKO.1 1263 CDS 100% 4.950 3.960 N Slc45a1 n/a
5 TRCN0000110839 GCTCCGTGTCATCTATGTCTT pLKO.1 967 CDS 100% 4.950 3.960 N Slc45a1 n/a
6 TRCN0000422389 CTGTTCCACCATCTACAATAT pLKO_005 1717 CDS 100% 13.200 9.240 N Slc45a1 n/a
7 TRCN0000437393 ACTCAGCTATCCTGGAGAAAC pLKO_005 1950 CDS 100% 10.800 7.560 N Slc45a1 n/a
8 TRCN0000110836 CCTGTGTGTCACCTACGAAAT pLKO.1 2353 CDS 100% 10.800 7.560 N Slc45a1 n/a
9 TRCN0000110838 CTGTGATTACTACCAGAGTAA pLKO.1 2137 CDS 100% 0.495 0.347 N Slc45a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.