Transcript: Human NM_173832.6

Homo sapiens ZFP41 zinc finger protein (ZFP41), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
ZFP41 (286128)
Length:
4786
CDS:
359..955

Additional Resources:

NCBI RefSeq record:
NM_173832.6
NBCI Gene record:
ZFP41 (286128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173832.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108041 TGGGCGGATCTTTAAGCACAA pLKO.1 634 CDS 100% 4.050 5.670 N ZFP41 n/a
2 TRCN0000108044 CCCTACGAATGCACGCACTGT pLKO.1 866 CDS 100% 0.880 1.232 N ZFP41 n/a
3 TRCN0000431222 GACGAAGAGCACGTCTTTGAT pLKO_005 524 CDS 100% 5.625 4.500 N ZFP41 n/a
4 TRCN0000108042 CGCTTCATTTAAAGATGACTT pLKO.1 553 CDS 100% 4.950 3.960 N ZFP41 n/a
5 TRCN0000433128 CCATCCATTGGACGTGTTTGG pLKO_005 1276 3UTR 100% 4.050 2.835 N ZFP41 n/a
6 TRCN0000431249 GAGAGTCTCTCTGATCAAGAC pLKO_005 1148 3UTR 100% 4.050 2.835 N ZFP41 n/a
7 TRCN0000108043 AGCCTTTAACTGCGGCTCCAA pLKO.1 808 CDS 100% 2.640 1.848 N ZFP41 n/a
8 TRCN0000435770 TGTGATGTCCACTCTGCTTAA pLKO_005 1370 3UTR 100% 10.800 6.480 N ZFP41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173832.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09989 pDONR223 100% 99.8% 100% None 69T>C n/a
2 ccsbBroad304_09989 pLX_304 0% 99.8% 100% V5 69T>C n/a
3 TRCN0000480854 CCCCTCGGTGCCCATACAAACCAC pLX_317 66.9% 99.8% 100% V5 69T>C n/a
Download CSV