Transcript: Human NM_174889.5

Homo sapiens NADH:ubiquinone oxidoreductase complex assembly factor 2 (NDUFAF2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
NDUFAF2 (91942)
Length:
632
CDS:
52..561

Additional Resources:

NCBI RefSeq record:
NM_174889.5
NBCI Gene record:
NDUFAF2 (91942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_174889.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064439 CGGACCAATTCGGGAACAAAT pLKO.1 125 CDS 100% 13.200 10.560 N NDUFAF2 n/a
2 TRCN0000289072 CGGACCAATTCGGGAACAAAT pLKO_005 125 CDS 100% 13.200 10.560 N NDUFAF2 n/a
3 TRCN0000064438 CCACCTACTATGGAGGAAATA pLKO.1 295 CDS 100% 13.200 9.240 N NDUFAF2 n/a
4 TRCN0000064441 GAATTGTAGAAGCAGCAAATA pLKO.1 200 CDS 100% 13.200 9.240 N NDUFAF2 n/a
5 TRCN0000289071 GAATTGTAGAAGCAGCAAATA pLKO_005 200 CDS 100% 13.200 9.240 N NDUFAF2 n/a
6 TRCN0000296158 AGAATGGGAAGCTTGGATTAG pLKO_005 258 CDS 100% 10.800 7.560 N NDUFAF2 n/a
7 TRCN0000310202 ATGCCTCTGCTCCATACTTTG pLKO_005 446 CDS 100% 10.800 7.560 N NDUFAF2 n/a
8 TRCN0000064442 AGGACAAACTATTCGAGAGAA pLKO.1 177 CDS 100% 4.950 3.465 N NDUFAF2 n/a
9 TRCN0000064440 CCTCCACCAGTTCAAACTCAA pLKO.1 415 CDS 100% 4.950 3.465 N NDUFAF2 n/a
10 TRCN0000289020 CCTCCACCAGTTCAAACTCAA pLKO_005 415 CDS 100% 4.950 3.465 N NDUFAF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174889.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04564 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04564 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478900 ATTGCTGCCCGTAGTTTCGGACCC pLX_317 87% 100% 100% V5 n/a
Download CSV