Transcript: Human NM_174892.4

Homo sapiens CD300 molecule like family member b (CD300LB), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CD300LB (124599)
Length:
2295
CDS:
126..731

Additional Resources:

NCBI RefSeq record:
NM_174892.4
NBCI Gene record:
CD300LB (124599)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_174892.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144694 GATACATGCAAGATCCTCATT pLKO.1 291 CDS 100% 4.950 6.930 N CD300LB n/a
2 TRCN0000139897 GCTCACCTACCAACAGCAATA pLKO.1 520 CDS 100% 10.800 7.560 N CD300LB n/a
3 TRCN0000141331 CCTTCAGCCAAAGAGAAACTT pLKO.1 1915 3UTR 100% 5.625 3.938 N CD300LB n/a
4 TRCN0000140973 CAGCAATATGGCAGTGTTCAT pLKO.1 533 CDS 100% 4.950 3.465 N CD300LB n/a
5 TRCN0000144023 CGGTGATGTTGAAATCATGTT pLKO.1 1568 3UTR 100% 4.950 3.465 N CD300LB n/a
6 TRCN0000139965 GACCAACTCAACACCGTCTTT pLKO.1 1104 3UTR 100% 4.950 3.465 N CD300LB n/a
7 TRCN0000141785 GACTAAAGACATGGCCACTTA pLKO.1 710 CDS 100% 4.950 3.465 N CD300LB n/a
8 TRCN0000140420 GCCCTTGAATGTGGTCACTTT pLKO.1 1653 3UTR 100% 4.950 3.465 N CD300LB n/a
9 TRCN0000139351 CAGAACTTCCAGAGTGCATCT pLKO.1 45 5UTR 100% 4.050 2.835 N CD300LB n/a
10 TRCN0000141884 GATGTTTACTGGTGTGGGATT pLKO.1 423 CDS 100% 4.050 2.835 N CD300LB n/a
11 TRCN0000139352 CCAACAGCAATATGGCAGTGT pLKO.1 529 CDS 100% 2.640 1.848 N CD300LB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174892.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09484 pDONR223 100% 84.4% 84.4% None 0_1ins111 n/a
2 ccsbBroad304_09484 pLX_304 0% 84.4% 84.4% V5 0_1ins111 n/a
3 TRCN0000467097 ACACAAACGCTCATCAGCCCTGGC pLX_317 59.4% 84.4% 84.4% V5 0_1ins111 n/a
Download CSV