Transcript: Human NM_174916.3

Homo sapiens ubiquitin protein ligase E3 component n-recognin 1 (UBR1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
UBR1 (197131)
Length:
7698
CDS:
17..5266

Additional Resources:

NCBI RefSeq record:
NM_174916.3
NBCI Gene record:
UBR1 (197131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_174916.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003423 GCGTTGAGTCTTCGATTAAAT pLKO.1 3852 CDS 100% 15.000 21.000 N UBR1 n/a
2 TRCN0000425453 ACCGTATTTGAGCGGGCAATA pLKO_005 2693 CDS 100% 10.800 15.120 N UBR1 n/a
3 TRCN0000415901 ATCAGGATCGGAATCTATTAA pLKO_005 3013 CDS 100% 15.000 10.500 N UBR1 n/a
4 TRCN0000374110 CTGGTCTTCATGTACGTTTAA pLKO_005 1863 CDS 100% 13.200 9.240 N Ubr1 n/a
5 TRCN0000003425 GCTGGTCTTCATGTACGTTTA pLKO.1 1862 CDS 100% 10.800 7.560 N UBR1 n/a
6 TRCN0000003424 GCTTTCACTATCCAGGCAATT pLKO.1 3992 CDS 100% 10.800 7.560 N UBR1 n/a
7 TRCN0000003426 CCAAGAGACTAATCAGATGTT pLKO.1 5218 CDS 100% 4.950 3.465 N UBR1 n/a
8 TRCN0000003427 GCAGAGAAGAAATGTATGATA pLKO.1 2064 CDS 100% 5.625 3.375 N UBR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174916.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.