Transcript: Human NM_174919.3

Homo sapiens Rho GTPase activating protein 27 (ARHGAP27), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ARHGAP27 (201176)
Length:
1394
CDS:
450..1241

Additional Resources:

NCBI RefSeq record:
NM_174919.3
NBCI Gene record:
ARHGAP27 (201176)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_174919.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283798 CTACGACTACCGGTTTGTGAG pLKO_005 725 CDS 100% 4.050 2.430 N ARHGAP27 n/a
2 TRCN0000268800 CCCACCTCTGTCCGAAGACTT pLKO_005 1214 CDS 100% 1.650 0.990 N ARHGAP27 n/a
3 TRCN0000268801 CTTCTACCTGCCTGCGCAGTA pLKO_005 617 CDS 100% 1.350 0.810 N ARHGAP27 n/a
4 TRCN0000283802 AGCGACTCAGAGAACGTCTAC pLKO_005 1035 CDS 100% 4.050 2.025 Y ARHGAP27 n/a
5 TRCN0000268799 TTCGAGTACACCGGCAAGGAC pLKO_005 498 CDS 100% 0.880 0.440 Y ARHGAP27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174919.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10389 pDONR223 100% 24.7% 23.1% None (many diffs) n/a
2 ccsbBroad304_10389 pLX_304 0% 24.7% 23.1% V5 (many diffs) n/a
3 TRCN0000465995 TCCAACACTCCGTGGGTCTAGACT pLX_317 100% 24.7% 23.1% V5 (many diffs) n/a
Download CSV