Transcript: Human NM_174969.4

Homo sapiens ST3 beta-galactoside alpha-2,3-sialyltransferase 3 (ST3GAL3), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
ST3GAL3 (6487)
Length:
2206
CDS:
189..1268

Additional Resources:

NCBI RefSeq record:
NM_174969.4
NBCI Gene record:
ST3GAL3 (6487)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_174969.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232799 TCGAATCCTCAACCCATATTT pLKO_005 947 CDS 100% 15.000 21.000 N ST3GAL3 n/a
2 TRCN0000232800 TCGCGTCATCACTGATCTAAG pLKO_005 1235 CDS 100% 10.800 15.120 N ST3GAL3 n/a
3 TRCN0000035718 GCACAATATCCAGCGAGAGAA pLKO.1 1187 CDS 100% 4.950 6.930 N ST3GAL3 n/a
4 TRCN0000232801 GTGTTTGGTGTATTATCATTT pLKO_005 1575 3UTR 100% 13.200 9.240 N ST3GAL3 n/a
5 TRCN0000277455 GTGTTTGGTGTATTATCATTT pLKO_005 1575 3UTR 100% 13.200 9.240 N St3gal3 n/a
6 TRCN0000232798 GAATTGACGACTATGACATTG pLKO_005 670 CDS 100% 10.800 7.560 N ST3GAL3 n/a
7 TRCN0000232797 TTTCGCAAGTGGGCTAGAATC pLKO_005 480 CDS 100% 10.800 7.560 N ST3GAL3 n/a
8 TRCN0000018832 GCCACCAAGTACGCAAACTTT pLKO.1 363 CDS 100% 5.625 3.938 N St3gal3 n/a
9 TRCN0000277466 GCCACCAAGTACGCAAACTTT pLKO_005 363 CDS 100% 5.625 3.938 N St3gal3 n/a
10 TRCN0000035717 CCTCCTGAATCTGGACTCTAA pLKO.1 326 CDS 100% 4.950 3.465 N ST3GAL3 n/a
11 TRCN0000035715 CGCAGGATTTGGCTATGACAT pLKO.1 1097 CDS 100% 4.950 3.465 N ST3GAL3 n/a
12 TRCN0000035714 GCAGGACTTTAAGTGGTTGAA pLKO.1 839 CDS 100% 4.950 3.465 N ST3GAL3 n/a
13 TRCN0000035716 GCCATCTTGTCAGTCACCAAA pLKO.1 552 CDS 100% 4.950 3.465 N ST3GAL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174969.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01534 pDONR223 100% 95.7% 95.4% None 118_119ins48 n/a
2 ccsbBroad304_01534 pLX_304 0% 95.7% 95.4% V5 118_119ins48 n/a
3 TRCN0000492269 CGTGAGCGCATCGCAAAACCGGGC pLX_317 35.8% 95.7% 95.4% V5 118_119ins48 n/a
Download CSV