Transcript: Mouse NM_175113.3

Mus musculus tRNA methyltransferase 6 (Trmt6), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Trmt6 (66926)
Length:
2820
CDS:
121..1614

Additional Resources:

NCBI RefSeq record:
NM_175113.3
NBCI Gene record:
Trmt6 (66926)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276774 AGGCACTGATAATCGAAATAT pLKO_005 393 CDS 100% 15.000 21.000 N Trmt6 n/a
2 TRCN0000276777 ATCGGAGTCATCCCAAATTAT pLKO_005 1433 CDS 100% 15.000 21.000 N Trmt6 n/a
3 TRCN0000276822 TTGAAGCCATCTACCCGTATT pLKO_005 604 CDS 100% 10.800 15.120 N Trmt6 n/a
4 TRCN0000177953 GAGTTCCCTCTCAACAAAGTA pLKO.1 889 CDS 100% 5.625 4.500 N Trmt6 n/a
5 TRCN0000276776 GAGTTCCCTCTCAACAAAGTA pLKO_005 889 CDS 100% 5.625 4.500 N Trmt6 n/a
6 TRCN0000178402 GCACTCCAGTTGAAGAAAGTA pLKO.1 968 CDS 100% 5.625 4.500 N Trmt6 n/a
7 TRCN0000285679 GCATTCTGCAGCTGGTAATTA pLKO_005 1643 3UTR 100% 15.000 10.500 N Trmt6 n/a
8 TRCN0000200119 CCTGAGGAAGATCCAGGTATT pLKO.1 2108 3UTR 100% 10.800 7.560 N Trmt6 n/a
9 TRCN0000177515 CTTTGTTGGAATGCTACACAA pLKO.1 1337 CDS 100% 4.950 3.465 N Trmt6 n/a
10 TRCN0000176485 CAAAGTAAACAGTCTCCTCAA pLKO.1 903 CDS 100% 4.050 2.835 N Trmt6 n/a
11 TRCN0000182764 CCAGAGAATAAGGAGCCCAAA pLKO.1 1102 CDS 100% 4.050 2.835 N Trmt6 n/a
12 TRCN0000200155 CCTCAGTGGTCTTTACGAGTT pLKO.1 873 CDS 100% 4.050 2.835 N Trmt6 n/a
13 TRCN0000182343 GAGATTGCTGAACAAGCGGAT pLKO.1 1009 CDS 100% 2.160 1.512 N Trmt6 n/a
14 TRCN0000197845 GCATACACATAGATGTATCTA pLKO.1 2306 3UTR 100% 0.563 0.394 N Trmt6 n/a
15 TRCN0000140733 GTCTGAAACCTGGCTCAGAAA pLKO.1 1395 CDS 100% 0.495 0.347 N TRMT6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03342 pDONR223 100% 85.9% 85.3% None (many diffs) n/a
2 ccsbBroad304_03342 pLX_304 0% 85.9% 85.3% V5 (many diffs) n/a
3 TRCN0000465684 CTGAATCTTTTTCCTGAGTGGAGG pLX_317 27.5% 85.9% 85.3% V5 (many diffs) n/a
Download CSV