Transcript: Mouse NM_175127.2

Mus musculus F-box protein 28 (Fbxo28), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Fbxo28 (67948)
Length:
4932
CDS:
18..1124

Additional Resources:

NCBI RefSeq record:
NM_175127.2
NBCI Gene record:
Fbxo28 (67948)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328357 GGCGATGTGTTAAGGTTATTT pLKO_005 1381 3UTR 100% 15.000 21.000 N Fbxo28 n/a
2 TRCN0000219800 TTATGTCCTACGACGAAATTA pLKO.1 250 CDS 100% 15.000 21.000 N FBXO28 n/a
3 TRCN0000201612 CCAGATCATAGGCGAACAGAA pLKO.1 938 CDS 100% 4.950 6.930 N Fbxo28 n/a
4 TRCN0000192261 CGAGGTTGTCACTGTTGAATA pLKO.1 460 CDS 100% 13.200 10.560 N Fbxo28 n/a
5 TRCN0000328355 CGAGGTTGTCACTGTTGAATA pLKO_005 460 CDS 100% 13.200 10.560 N Fbxo28 n/a
6 TRCN0000201128 CCTGTGTCAGAAGCAAGTTAA pLKO.1 359 CDS 100% 13.200 9.240 N Fbxo28 n/a
7 TRCN0000192297 CGAGAACATCCTCAGCTTTAT pLKO.1 233 CDS 100% 13.200 9.240 N Fbxo28 n/a
8 TRCN0000328354 CGAGAACATCCTCAGCTTTAT pLKO_005 233 CDS 100% 13.200 9.240 N Fbxo28 n/a
9 TRCN0000328424 TCGAGCAGACCCAGATCATAG pLKO_005 928 CDS 100% 10.800 7.560 N Fbxo28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02739 pDONR223 100% 89.3% 94.8% None (many diffs) n/a
2 ccsbBroad304_02739 pLX_304 0% 89.3% 94.8% V5 (many diffs) n/a
3 TRCN0000491963 GCACTAACATACGTCAGGTTATAC pLX_317 25.1% 89.3% 94.8% V5 (many diffs) n/a
Download CSV