Transcript: Mouse NM_175133.2

Mus musculus guanylyl cyclase domain containing 1 (Gucd1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gucd1 (68778)
Length:
2985
CDS:
186..905

Additional Resources:

NCBI RefSeq record:
NM_175133.2
NBCI Gene record:
Gucd1 (68778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283844 TACCGGCTGCATCTTCTATAA pLKO_005 773 CDS 100% 0.000 0.000 N Gucd1 n/a
2 TRCN0000283849 CATCGTCCTGCGTGGCTATAA pLKO_005 746 CDS 100% 13.200 10.560 N Gucd1 n/a
3 TRCN0000268910 CAAGTCCAGTCACCCATATTA pLKO_005 2212 3UTR 100% 15.000 10.500 N Gucd1 n/a
4 TRCN0000283847 CTATCATCCAGCAGCTATATC pLKO_005 253 CDS 100% 13.200 9.240 N Gucd1 n/a
5 TRCN0000268959 TGCAGCACCAGCATCAGTAAC pLKO_005 819 CDS 100% 10.800 7.560 N Gucd1 n/a
6 TRCN0000130769 GTAACTTTGAGGAGGCCAGAA pLKO.1 835 CDS 100% 4.050 2.835 N GUCD1 n/a
7 TRCN0000130491 GAAATGCACAGTGAGTGTGAA pLKO.1 566 CDS 100% 4.950 3.465 N GUCD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12747 pDONR223 100% 92% 95.8% None (many diffs) n/a
2 ccsbBroad304_12747 pLX_304 0% 92% 95.8% V5 (many diffs) n/a
3 TRCN0000469738 AACCATTTTGTACGTGACACCTAA pLX_317 49.5% 92% 95.8% V5 (many diffs) n/a
Download CSV