Transcript: Mouse NM_175151.4

Mus musculus TatD DNase domain containing 1 (Tatdn1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tatdn1 (69694)
Length:
1366
CDS:
31..825

Additional Resources:

NCBI RefSeq record:
NM_175151.4
NBCI Gene record:
Tatdn1 (69694)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175151.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176674 CCTCACCTGTAAAGTCTAAAT pLKO.1 978 3UTR 100% 13.200 18.480 N Tatdn1 n/a
2 TRCN0000445839 GTGACCGACGGATTAGGTAAA pLKO_005 1020 3UTR 100% 10.800 15.120 N Tatdn1 n/a
3 TRCN0000176708 CTGTCAGAACAAACACAATTA pLKO.1 442 CDS 100% 13.200 9.240 N Tatdn1 n/a
4 TRCN0000422240 TGTTTCTTCATTGTCGCAATT pLKO_005 467 CDS 100% 10.800 7.560 N Tatdn1 n/a
5 TRCN0000177684 CAACCTGACAGATCCTATGTT pLKO.1 63 CDS 100% 5.625 3.938 N Tatdn1 n/a
6 TRCN0000178714 CATCAACCTGACAGATCCTAT pLKO.1 60 CDS 100% 4.950 3.465 N Tatdn1 n/a
7 TRCN0000177103 CATCAAGATGACTTACAAGAT pLKO.1 112 CDS 100% 4.950 3.465 N Tatdn1 n/a
8 TRCN0000177546 CCAACCTTTCAATAGCAAGAA pLKO.1 1200 3UTR 100% 4.950 3.465 N Tatdn1 n/a
9 TRCN0000435932 AGCTATCCAGATTGGTGTTAA pLKO_005 144 CDS 100% 13.200 7.920 N Tatdn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175151.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09136 pDONR223 100% 79.2% 80.1% None (many diffs) n/a
2 ccsbBroad304_09136 pLX_304 0% 79.2% 80.1% V5 (many diffs) n/a
3 TRCN0000480484 AAATAACTTCCTAAAATAAATTGC pLX_317 49.6% 79.2% 80.1% V5 (many diffs) n/a
Download CSV