Construct: ORF TRCN0000480484
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001971.1_s317c1
- Derived from:
- ccsbBroadEn_09136
- DNA Barcode:
- AAATAACTTCCTAAAATAAATTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TATDN1 (83940)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480484
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | NM_032026.4 | 99.8% | 99.6% | 482T>C |
2 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_017013895.2 | 94.5% | 94.2% | 0_1ins48;434T>C |
3 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_024447293.1 | 92.4% | 92.2% | 21_22ins66;416T>C |
4 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | NM_001317889.1 | 89% | 88.5% | 482T>C;589_632del;637_700del |
5 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XR_428386.4 | 87% | (many diffs) | |
6 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_006716671.3 | 85% | 77.2% | (many diffs) |
7 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_017013896.2 | 85% | 77.2% | (many diffs) |
8 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_017013897.2 | 85% | 77.2% | (many diffs) |
9 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_024447294.1 | 85% | 77.2% | (many diffs) |
10 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_006716666.4 | 84.2% | 83.7% | (many diffs) |
11 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | NM_001146160.1 | 84% | 83.8% | 0_1ins141;341T>C |
12 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_017013898.2 | 84% | 83.8% | 0_1ins141;341T>C |
13 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_024447295.1 | 84% | 83.8% | 0_1ins141;341T>C |
14 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_011517331.3 | 82.4% | 81.9% | (many diffs) |
15 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | NM_001317890.1 | 81.7% | 81.4% | 0_1ins48;39_40ins114;320T>C |
16 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | NR_027427.1 | 76.8% | (many diffs) | |
17 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_006716667.3 | 75.9% | 68.7% | (many diffs) |
18 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_006716668.3 | 75.9% | 68.7% | (many diffs) |
19 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_006716669.3 | 75.9% | 68.7% | (many diffs) |
20 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_006716670.3 | 74.9% | 74.4% | (many diffs) |
21 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | XM_017013899.1 | 66.5% | 65.9% | (many diffs) |
22 | human | 83940 | TATDN1 | TatD DNase domain containing 1 | NM_001317891.1 | 51% | 50.8% | 0_1ins435;47T>C |
23 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XM_006521365.3 | 88.3% | 90.2% | (many diffs) |
24 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XM_006521367.2 | 83.8% | 85.5% | (many diffs) |
25 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XM_006521366.3 | 81.2% | 81.1% | (many diffs) |
26 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | NM_175151.4 | 79.2% | 80.1% | (many diffs) |
27 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XM_006521368.2 | 74.1% | 76% | (many diffs) |
28 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XR_384041.3 | 68.5% | (many diffs) | |
29 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XM_006521373.3 | 67.9% | 69.3% | (many diffs) |
30 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XM_006521371.2 | 67.7% | 70% | (many diffs) |
31 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XM_006521372.2 | 67.7% | 70% | (many diffs) |
32 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XM_006521374.2 | 67.7% | 70% | (many diffs) |
33 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XM_011245726.1 | 67.7% | 70% | (many diffs) |
34 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XM_011245727.1 | 67.7% | 70% | (many diffs) |
35 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XR_384042.3 | 57% | (many diffs) | |
36 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XR_384043.3 | 48.9% | (many diffs) | |
37 | mouse | 69694 | Tatdn1 | TatD DNase domain containing 1 | XM_017316744.1 | 40.2% | 39.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 960
- ORF length:
- 891
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gagtcgcttc aagtttatcg atattggtat caacttgact gaccctatgt 121 tcagaggaat ttataggggg gttcaaaagc atcaagatga cttacaggat gtaataggga 181 gagctgtcga gattggtgtt aaaaagttta tgattacagg tggaaatcta caagacagta 241 aagatgcact gcatttggca caaacaaatg gtatgttttt cagtacagtt ggatgtcatc 301 ctacaagatg tggtgaattt gaaaagaata accctgatct ttacttaaag gagttgctaa 361 atcttgctga aaacaataaa gggaaagttg tggcaatagg agaatgcgga cttgattttg 421 accgactgca gttttgtccc aaagatactc aactcaaata ttttgaaaaa cagtttgaac 481 tgtcagaaca aacaaaatta ccaatgtttc ttcattGTCG AAACTCACAT GCTGAATTTT 541 TGGACATAAC GAAAAGAAAT AGAGATCGGT GTGTAGGGGG AGTGGTGCAT TCATTTGATG 601 GTACCAAGGA AGCAGCAGCT GCTTTGATTG ACTTGGATCT TTATATAGGA TTTAATGGTT 661 GCTCACTGAA AACTGAAGCT AATTTGGAAG TTTTGAAGTC AATTCCTAGT GAAAAATTAA 721 TGATTGAGAC AGATGCACCT TGGTGTGGAG TCAAAAGTAC ACATGCTGGA TCAAAATATA 781 TAAGAACTGC ATTTCCTACC AAAAAGAAGT GGGAAAGTGG GCACTGCTTA AAAGACAGAA 841 ATGAACCCTG CCATATAATT CAAATATTGG AGATAATGTC AGCAGTGAGA GATGAGGATC 901 CACTGGAATT AGCCAATACA CTATATAACA ATACTATTAA AGTATTTTTT CCTGGAATAT 961 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1021 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1081 TTTATATATC TTGTGGAAAG GACGAAAATA ACTTCCTAAA ATAAATTGCA CGCGTTAAGT 1141 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt