Transcript: Mouse NM_175180.3

Mus musculus WD repeat domain 44 (Wdr44), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Wdr44 (72404)
Length:
4189
CDS:
413..3160

Additional Resources:

NCBI RefSeq record:
NM_175180.3
NBCI Gene record:
Wdr44 (72404)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175180.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245409 ATATGGTGAACGTGCTATAAA pLKO_005 1753 CDS 100% 15.000 21.000 N Wdr44 n/a
2 TRCN0000241311 TTACTCCAGAACCTGATATAG pLKO_005 1071 CDS 100% 13.200 10.560 N Wdr44 n/a
3 TRCN0000241308 GAAGTTGCCAACAGGTATTAA pLKO_005 1543 CDS 100% 15.000 10.500 N Wdr44 n/a
4 TRCN0000241310 GGCTTTGTAAATACCAATATA pLKO_005 3989 3UTR 100% 15.000 10.500 N Wdr44 n/a
5 TRCN0000241309 TGACTTCTGGGAAGGTATTAA pLKO_005 2908 CDS 100% 15.000 10.500 N Wdr44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175180.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12052 pDONR223 100% 63.4% 66% None (many diffs) n/a
2 ccsbBroad304_12052 pLX_304 0% 63.4% 66% V5 (many diffs) n/a
3 TRCN0000481171 GTGGTGGAGGGGTATGGGCTCTTT pLX_317 24.8% 63.4% 66% V5 (many diffs) n/a
Download CSV