Transcript: Mouse NM_175207.4

Mus musculus ankyrin repeat domain 9 (Ankrd9), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ankrd9 (74251)
Length:
2558
CDS:
412..1392

Additional Resources:

NCBI RefSeq record:
NM_175207.4
NBCI Gene record:
Ankrd9 (74251)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175207.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246504 GTAGGTCCAGCTCGATGTGAA pLKO_005 1168 CDS 100% 4.950 6.930 N Ankrd9 n/a
2 TRCN0000246503 GCTTGACCTGCTAGTACTGTA pLKO_005 1131 CDS 100% 4.950 3.960 N Ankrd9 n/a
3 TRCN0000246502 TGTGCTGTCAGCCTCATAAAT pLKO_005 1725 3UTR 100% 15.000 10.500 N Ankrd9 n/a
4 TRCN0000246505 CAGGTGTTGGTCACCACTATC pLKO_005 1288 CDS 100% 10.800 7.560 N Ankrd9 n/a
5 TRCN0000257546 TTCGAGATGGCAGTGGCTTTA pLKO_005 968 CDS 100% 10.800 7.560 N Ankrd9 n/a
6 TRCN0000197424 CTCATCTCACACTGAATCATT pLKO.1 1836 3UTR 100% 5.625 3.938 N Ankrd9 n/a
7 TRCN0000242908 TGGGTGAGGACAAGTTCCAGT pLKO_005 1223 CDS 100% 2.640 1.848 N ANKRD9 n/a
8 TRCN0000177184 GCTGTGAAATTCAACCTTTGT pLKO.1 2272 3UTR 100% 4.950 2.970 N Ankrd9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175207.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.