Transcript: Mouse NM_175280.3

Mus musculus cilia and flagella associated protein 61 (Cfap61), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Cfap61 (78774)
Length:
1561
CDS:
67..870

Additional Resources:

NCBI RefSeq record:
NM_175280.3
NBCI Gene record:
Cfap61 (78774)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264851 TGCACACCCTTCTAGGTAATG pLKO_005 1290 3UTR 100% 10.800 15.120 N Cfap61 n/a
2 TRCN0000283197 GTTTGGGAGGCTCAACATAAT pLKO_005 180 CDS 100% 13.200 10.560 N Cfap61 n/a
3 TRCN0000264853 ATTCCATGTCTGAACTATAAT pLKO_005 544 CDS 100% 15.000 10.500 N Cfap61 n/a
4 TRCN0000215935 CCTTATAGTGCCAACATATTT pLKO.1 477 CDS 100% 15.000 10.500 N Cfap61 n/a
5 TRCN0000264852 CACCTCTGAACACGCTGTTTA pLKO_005 359 CDS 100% 13.200 9.240 N Cfap61 n/a
6 TRCN0000215966 CATTCCATGTCTGAACTATAA pLKO.1 543 CDS 100% 13.200 9.240 N Cfap61 n/a
7 TRCN0000264850 TCCTTATAGTGCCAACATATT pLKO_005 476 CDS 100% 13.200 9.240 N Cfap61 n/a
8 TRCN0000202207 CCCTCCTTTCTACTTCCTGTT pLKO.1 1039 3UTR 100% 4.050 2.025 Y Cfap61 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.