Transcript: Mouse NM_175285.3

Mus musculus transmembrane protein 62 (Tmem62), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tmem62 (96957)
Length:
2886
CDS:
238..2169

Additional Resources:

NCBI RefSeq record:
NM_175285.3
NBCI Gene record:
Tmem62 (96957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175285.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175741 GAAGTTCTGTTCGGAAACTAT pLKO.1 474 CDS 100% 5.625 7.875 N Tmem62 n/a
2 TRCN0000298119 GAAGTTCTGTTCGGAAACTAT pLKO_005 474 CDS 100% 5.625 7.875 N Tmem62 n/a
3 TRCN0000176208 GCAGGTTTATTCTTGCTACTT pLKO.1 1992 CDS 100% 4.950 6.930 N Tmem62 n/a
4 TRCN0000293081 GCAGGTTTATTCTTGCTACTT pLKO_005 1992 CDS 100% 4.950 6.930 N Tmem62 n/a
5 TRCN0000244152 GGCCTAAGAGACCCTATAATT pLKO_005 815 CDS 100% 15.000 10.500 N TMEM62 n/a
6 TRCN0000175543 CCAGACAACATGAAGTAGAAT pLKO.1 569 CDS 100% 5.625 3.938 N Tmem62 n/a
7 TRCN0000293139 CCAGACAACATGAAGTAGAAT pLKO_005 569 CDS 100% 5.625 3.938 N Tmem62 n/a
8 TRCN0000175191 CACACTGATTACATTCAGATA pLKO.1 1575 CDS 100% 4.950 2.970 N Tmem62 n/a
9 TRCN0000298138 CACACTGATTACATTCAGATA pLKO_005 1575 CDS 100% 4.950 2.970 N Tmem62 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175285.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12662 pDONR223 100% 58.1% 56.2% None (many diffs) n/a
2 ccsbBroad304_12662 pLX_304 0% 58.1% 56.2% V5 (many diffs) n/a
3 TRCN0000469273 ATCGAAAAACCCCCCCGTTCATTC pLX_317 28.6% 58.1% 56.2% V5 (many diffs) n/a
Download CSV