Transcript: Mouse NM_175358.4

Mus musculus zinc finger, DHHC domain containing 15 (Zdhhc15), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc15 (108672)
Length:
5517
CDS:
266..1279

Additional Resources:

NCBI RefSeq record:
NM_175358.4
NBCI Gene record:
Zdhhc15 (108672)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175358.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418446 ATGTGCAATATATCGATATAG pLKO_005 1720 3UTR 100% 13.200 18.480 N Zdhhc15 n/a
2 TRCN0000415005 GATTGCCTTAGAGTCTAATTC pLKO_005 1593 3UTR 100% 13.200 18.480 N Zdhhc15 n/a
3 TRCN0000124617 CTTAGCTTATTCCGTTCTCTA pLKO.1 796 CDS 100% 4.950 6.930 N Zdhhc15 n/a
4 TRCN0000124615 CGATAATAAGAAGTTCTGGTT pLKO.1 1090 CDS 100% 2.640 3.696 N Zdhhc15 n/a
5 TRCN0000124614 CCCTGTATCAAGTATCTGAAA pLKO.1 1839 3UTR 100% 4.950 3.960 N Zdhhc15 n/a
6 TRCN0000124616 CCTCATACTCTATCATGCCAT pLKO.1 436 CDS 100% 2.640 2.112 N Zdhhc15 n/a
7 TRCN0000414704 TGGGTGCCAGTGCTCGTTATT pLKO_005 329 CDS 100% 13.200 9.240 N Zdhhc15 n/a
8 TRCN0000145236 GTGATTCTCTTTGGTTACCAT pLKO.1 947 CDS 100% 3.000 2.100 N ZDHHC15 n/a
9 TRCN0000124618 CCACTTGTCCTATACAGACAA pLKO.1 526 CDS 100% 0.495 0.347 N Zdhhc15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175358.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05099 pDONR223 100% 93.7% 97.9% None (many diffs) n/a
2 ccsbBroad304_05099 pLX_304 0% 93.7% 97.9% V5 (many diffs) n/a
3 TRCN0000478971 ATGGGTTCTGTAGGGCCGCCGCAA pLX_317 36.5% 93.7% 97.9% V5 (many diffs) n/a
Download CSV